View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_494 (Length: 230)
Name: NF11737A_low_494
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_494 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34092601 - 34092372
Alignment:
| Q |
1 |
attataattaatttaaaaaatcttttattgtaggcttgttaaagannnnnnnaaaaccaatattgatgttttaattaaatttgaaagatattttnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34092601 |
attataattaatttaaaaaatcttttattgtaggcttgttaaagatttttttaaaaccaattttgatgttttaattaaatttgaaagatattttaaaaaa |
34092502 |
T |
 |
| Q |
101 |
ncgatgttatgttaaagatgaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgtgatt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092501 |
acgatgttatgttaaagattaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatgtgatt |
34092402 |
T |
 |
| Q |
201 |
tgttttcaaaggagattgtatatgatgtga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34092401 |
tgttttcaaaggagattgtatatgatgtga |
34092372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University