View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_495 (Length: 230)
Name: NF11737A_low_495
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_495 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 38359303 - 38359492
Alignment:
| Q |
21 |
atatcatgcaatcagatttacaatgggatcaattcattagaagcaggatcctaaggaacnnnnnnnccagtcgattatcatgtttcttcatctgttttga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
38359303 |
atatcatgcaatcagatttacaatgggatcagttcattagaagcaggatcctaaggaacaaaaaa-ccagtcaattatcatgtttcgtcatctgttttga |
38359401 |
T |
 |
| Q |
121 |
ttggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattcgaaatggggaaaatattaacttctggattgattcctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38359402 |
gtggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattggaaatggggaaaatattaacttctggattgattcctg |
38359492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University