View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_508 (Length: 229)
Name: NF11737A_low_508
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_508 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 99 - 217
Target Start/End: Complemental strand, 41760655 - 41760537
Alignment:
| Q |
99 |
attagaatgtaatcaatttccgacaatttatctccctcgtcatcatgtgcatcaaatagttcaacttcttctccttgttcttcgtctatgaaaattatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760655 |
attagaatgtaatcaatttccgacaatttatctccctcatcatcatgtgcatcaaatagttcaacttcttctccttgttcttcgtctatgaaaattatat |
41760556 |
T |
|
| Q |
199 |
tttcaatattttcttcgac |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41760555 |
tttcaatattttcttcgac |
41760537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 41795456 - 41795385
Alignment:
| Q |
99 |
attagaatgtaatcaatttccgacaatttatctccctcgtcatcatgtgcatcaaatagttcaacttcttct |
170 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41795456 |
attagaatgtaatcaatttccgaccctttatctccgtcttcatcatctgcatcaaatagttcaacttcttct |
41795385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University