View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_512 (Length: 229)
Name: NF11737A_low_512
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_512 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 36369619 - 36369391
Alignment:
| Q |
1 |
tcaggtcttaaacatctagtagacggagtgaagaaacatcacaatgtcaagtatggtcctatttccttaacttacttttttattgacaacagttttcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36369619 |
tcaggtcttaaacatctagtagacggagtgaagaaacatcacaatgtcaagtatggtcctatttccttaacttacttttttattgacaacagttttcaga |
36369520 |
T |
|
| Q |
101 |
gaatgactgtttgatacgttgctcagcgaattaattattcgaattcttaattggttactttgttgatggacagaaatgtttatgtatggcatgcactagc |
200 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36369519 |
gaatgattgtttgatgcgttgctcagcgaattaattattcgaattcttaattggttactttgttgatggacagaaatgtttatgtatggcatgcactagc |
36369420 |
T |
|
| Q |
201 |
tggttattggggaggagtgaagccagcag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36369419 |
tggttattggggaggagtgaagccagcag |
36369391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 229
Target Start/End: Complemental strand, 21375598 - 21375533
Alignment:
| Q |
164 |
tgatggacagaaatgtttatgtatggcatgcactagctggttattggggaggagtgaagccagcag |
229 |
Q |
| |
|
|||||| |||| |||||||||| |||||||| ||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
21375598 |
tgatgggcagatatgtttatgtttggcatgctctagctggttactggggtggagtgaagccggcag |
21375533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University