View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_517 (Length: 228)
Name: NF11737A_low_517
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_517 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 36 - 152
Target Start/End: Original strand, 9462216 - 9462349
Alignment:
| Q |
36 |
agtagagtgaataattctgagatctcaaactaagatgattaacaactaatgaacttgaacaatt-----------------gtttattcatttaattaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
9462216 |
agtagagtgaataattctgagatctcaaactaagatgattaacaaataatcaacttgaacaattattaatgttgcttgcaggtttattcatttaattaaa |
9462315 |
T |
|
| Q |
119 |
actgtagcacctgatgcagaaaactatgcagaag |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9462316 |
actgtagcacctgatgcagaaaactatgcagaag |
9462349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 206
Target Start/End: Original strand, 9462363 - 9462391
Alignment:
| Q |
178 |
gctcgctaagcgatcatttctgttatgac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9462363 |
gctcgctaagcgatcatttctgttatgac |
9462391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University