View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_521 (Length: 227)
Name: NF11737A_low_521
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_521 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 47628255 - 47628052
Alignment:
| Q |
16 |
ggacatccactggaggaggagagggaatagttggtggaatgacctgaatatgattcatgtccagctgaatggcctgaatttcttctcgtcctgccgtgca |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47628255 |
ggacatacactggaggaggagagggaatagttggtggaatgacctgaatatgattcatgtccagctgaatggcctgaatttcttctcgtcctgccgtgca |
47628156 |
T |
|
| Q |
116 |
tgaaaaatgctggttccatgggaaatggcatttcaattgagacattattaagatatgaaacaacagttcccattgtaggcctatcatctggatattcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47628155 |
tgaaaaatgctggttccatgggaaatggcatttcaattgagacattattaagatatgaaacaacagttcccattgtaggcctatcatctggattttcttg |
47628056 |
T |
|
| Q |
216 |
gaca |
219 |
Q |
| |
|
|||| |
|
|
| T |
47628055 |
gaca |
47628052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 219
Target Start/End: Complemental strand, 47619958 - 47619875
Alignment:
| Q |
136 |
ggaaatggcatttcaattgagacattattaagatatgaaacaacagttcccattgtaggcctatcatctggatattcttcgaca |
219 |
Q |
| |
|
|||||||||| ||||| |||| |||| ||||||||||||| || ||| |||||||||| ||| ||| ||||| ||||| |||| |
|
|
| T |
47619958 |
ggaaatggcagttcaagtgagtgattagtaagatatgaaacgactgttgccattgtaggtctagcatttggattttcttggaca |
47619875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University