View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_528 (Length: 227)
Name: NF11737A_low_528
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_528 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 19311278 - 19311475
Alignment:
| Q |
14 |
gatggacatttgagaaaggcattgctcaaacggtttcgactgaaatttgaggaaatttctgttaggtttaaaaactgtcgttaggttagaggaaattatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19311278 |
gatggacatttgagaaaggcattgctcaaacggttttgactgaaatttgaggaaatttctgttaggtttaaaaactgtcgttaggttagaggaaattatc |
19311377 |
T |
|
| Q |
114 |
atttggagcccttacggtaaatagaagctaccacgtgaatccnnnnnnnaactctagaaatgaaagtttnnnnnnngaggcaaaattgcaccacaggt |
211 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19311378 |
atctggagcccttacggtaaatagaagctaccacgtgaaccctttttttaactctagaaatgaaagtttaaaaaaagaggcaaaattgcaccacaggt |
19311475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University