View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_535 (Length: 226)
Name: NF11737A_low_535
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_535 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 38935997 - 38936218
Alignment:
| Q |
5 |
actttcgtgtttggtagcaatctcaacgccgaaacggaacaaggcgaaactggttcatctcggagcagtgaaggtcttctcgaaccttctaatcgcgtca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38935997 |
actttcgtgtttggtagcaatctcaacgccgaaacggaacaaggcgaaactggttcatctcggagcagtgaaggtcttctcgaaccttctaaccgcgtca |
38936096 |
T |
|
| Q |
105 |
catagtttgtgtgtttctgtgacggagaaggtgttgaaacttctagaaactgtgtcgtcgacgaaggaggggaggtcggggatatgtgaagcgccgtcgt |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38936097 |
cctagtttgtgtgtttctgtgacggagaaggtgttgaaacttctagaaacggtgtcgtcgacgaaggaggggaggtcggagatatgtgaagcgccgtcgt |
38936196 |
T |
|
| Q |
205 |
gtggggcggcggtagtggacaa |
226 |
Q |
| |
|
||| || |||| ||||| |||| |
|
|
| T |
38936197 |
gtgtggtggcgatagtgaacaa |
38936218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University