View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_538 (Length: 226)
Name: NF11737A_low_538
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_538 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 25755487 - 25755681
Alignment:
| Q |
16 |
catcacagaatggaatcggaaaaaaggctctggatgatatacaaatacttcacacagacacactagttaaagaggtaactgaaaacggttcaatcagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25755487 |
catcacagaatggaatcggaaaaaaggctctggatgatatacaaatacttcacacagacacactagttaaagaggtaactgaaaacggttcaatcagaat |
25755586 |
T |
 |
| Q |
116 |
tcaattgagattgtttaatcttttcatggaaaatatttaaatttatgggtaacttgtcaggtggaaagggtgttcagtgcaaatcatcctgatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25755587 |
tcaattgagattgtttaatcttttcatggaaaatatttaaatttttgggtaacttgtcaggtggaaagggtgttcagtgcaaatcatcctgatgt |
25755681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University