View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_539 (Length: 226)
Name: NF11737A_low_539
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_539 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 31141873 - 31141657
Alignment:
| Q |
8 |
tgactactttttattgtaacattctgagggatttggcggaacagaaacaaaggcatatttcaaaatgttaggaaagatattcatgcttcaactaataaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141873 |
tgactactttttattgtaacattctgatagatttggcggaacagaaacaaagacatatttcaaaatgttaggaaagatattcatgcttcaactaataaag |
31141774 |
T |
 |
| Q |
108 |
ttccctcttatcactcttgtatgatatgctcttgatcgtatatataacaaatgggcatttcaccatcttccttgatgccccatgcaaaaggttatataaa |
207 |
Q |
| |
|
||| ||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141773 |
ttctctcttatcactcttgtacggtatgctcttgatcgtatagataacaaatgggcatttcaccatcttccttgatgccccatgcaaaaggttatataaa |
31141674 |
T |
 |
| Q |
208 |
agtatgttacaacggga |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31141673 |
agtatgttacaacggga |
31141657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University