View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_549 (Length: 224)
Name: NF11737A_low_549
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_549 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 48143978 - 48143794
Alignment:
| Q |
15 |
aagaatatatagagaatatatgattatatataagtcagaattaatcttcataaatggattaattaacttttccagcctactaaa-gtactgcatatctgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
48143978 |
aagaatatatagagaatatatgattata----agtcagaattaatcttcataaatg-attaattaacttttccagcctactaaaagtactgcatatctag |
48143884 |
T |
|
| Q |
114 |
attattaacacgattaccacaaataaactagaccaatgatgaacttgtatcatatccatccacgtataaatatactgggcttgtgaaaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48143883 |
attattaacacgattaccacaaataaactagaccaatgatgaacttgtatcatatccatccacgtataaatataatgggcttgtgaaaat |
48143794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University