View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_549 (Length: 224)

Name: NF11737A_low_549
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_549
NF11737A_low_549
[»] chr1 (1 HSPs)
chr1 (15-203)||(48143794-48143978)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 48143978 - 48143794
Alignment:
15 aagaatatatagagaatatatgattatatataagtcagaattaatcttcataaatggattaattaacttttccagcctactaaa-gtactgcatatctgg 113  Q
    ||||||||||||||||||||||||||||    |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |    
48143978 aagaatatatagagaatatatgattata----agtcagaattaatcttcataaatg-attaattaacttttccagcctactaaaagtactgcatatctag 48143884  T
114 attattaacacgattaccacaaataaactagaccaatgatgaacttgtatcatatccatccacgtataaatatactgggcttgtgaaaat 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
48143883 attattaacacgattaccacaaataaactagaccaatgatgaacttgtatcatatccatccacgtataaatataatgggcttgtgaaaat 48143794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University