View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_567 (Length: 221)
Name: NF11737A_low_567
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_567 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 121 - 221
Target Start/End: Original strand, 46604216 - 46604315
Alignment:
| Q |
121 |
gtgatatgagacatattagaaacactctctttttaatattatctttacatttcactttttattgggtttaaactcacgtggttttcaccactttatacga |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
46604216 |
gtgatatgaggcatattagaaacactctctttttaatattatctttacatttcactttttattggg-ttaaactcacgtggctttcaccactttatacga |
46604314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 46606057 - 46605982
Alignment:
| Q |
7 |
acttcatcacctatcttaagaatttatctgcctcagcctcataagcattagtcctccatgataaagaaaatctaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46606057 |
acttcatcacctatcttaagaatttatctgcctcagcctcataagcattagtcctccatgataaagaaaatttaaa |
46605982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 46604438 - 46604383
Alignment:
| Q |
74 |
aaatctaaactcttgcttactattgtcaaagtatcacaagtaggtgagtgatatga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46604438 |
aaatctaaactcttgcttactattgtcaaagtatcacaagtaggtgagtgatatga |
46604383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 121 - 167
Target Start/End: Original strand, 46604014 - 46604060
Alignment:
| Q |
121 |
gtgatatgagacatattagaaacactctctttttaatattatcttta |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46604014 |
gtgatatgagacatattagaaacactttctttttaatattatcttta |
46604060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University