View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_570 (Length: 221)
Name: NF11737A_low_570
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_570 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 14859675 - 14859872
Alignment:
| Q |
11 |
acatcactcctgaaaaaagtcagatctacaaatagacctaaaatgttgaaaaaattcaggatcaaattcatccggac---gacatttatctagatgcatt |
107 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
14859675 |
acatcactcctcaaaaatgtcagagctacaaatagaccaaaaatgttgaaaaaattcaggatcaaatccatccggaccaggacatttatctggatgcatt |
14859774 |
T |
|
| Q |
108 |
gagaacataacatgcttgaattcttgaggctgaaaggcgcaattaaaaaattattatcatcacttgtaattaaagtctcaatagcatcaataaccagc |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14859775 |
gagaacataacatccttgaattcttgaggctgaaaggcgcaattaaaaaattattatcatcacttgtaattacagtctcaatagcatcaataaccagc |
14859872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University