View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_571 (Length: 220)
Name: NF11737A_low_571
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_571 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 10 - 192
Target Start/End: Complemental strand, 18256615 - 18256433
Alignment:
| Q |
10 |
gatggacatcaatgtattgatcagtttcatccaatatatcttccttgaataatgaaaacaactatgtattagcaatcttatttatagaataaactgtatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18256615 |
gatggacatcaatgtattgatcagtttcatccaatatatcttccttgaataatgaaaacaactatgtattagcaatcttatttatagtataaattgtatt |
18256516 |
T |
 |
| Q |
110 |
aacatgtgaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagacaaacacagatgcgaacaccaaac |
192 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
18256515 |
aacatgggaaaatcgaattgctaattatttttataaggtgtctataatgataagaaagataaacacagatgcgaacactaaac |
18256433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University