View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_576 (Length: 219)
Name: NF11737A_low_576
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_576 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 26964850 - 26965034
Alignment:
| Q |
16 |
acatcaatcttccttcataaacaagaaaggaagatgcaatgcattcggtattctaaactcccccaacccccnnnnnnntggaattggccttgagaaaagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26964850 |
acatcaatcttccttcataaacaagaaaggaagatgcaatgcattcggtattctaaactcccccaacccccaaaaaaatggaattggccttgagaaaagt |
26964949 |
T |
|
| Q |
116 |
tgagtttataaagtccctcttaccctgtcactaccatctttctaatcagatgaccataatgaatgtacatctgatgttggatatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26964950 |
tgagtttataaagtccctcttaccctgtcactaccatctttctaatcagatgaccataatgaatgtacatctgatgttggatatt |
26965034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 119 - 195
Target Start/End: Original strand, 27020103 - 27020180
Alignment:
| Q |
119 |
gtttataaagtccctcttaccc-tgtcactaccatctttctaatcagatgaccataatgaatgtacatctgatgttgg |
195 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||| |||||| | ||||| ||||| ||||||||||| ||||| |
|
|
| T |
27020103 |
gtttatcaagtccctcttacccctgtcactatcatctacttaatcaaaagaccaaaatgactgtacatctgaggttgg |
27020180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University