View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_581 (Length: 217)
Name: NF11737A_low_581
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_581 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 217
Target Start/End: Complemental strand, 22044114 - 22043904
Alignment:
| Q |
7 |
tattcctattttaaatgtcttcgctatttctggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatga |
106 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22044114 |
tattcctattttaaatgtctttgctatttttggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatga |
22044015 |
T |
|
| Q |
107 |
taaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatgaaacctataacaaaattacttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22044014 |
taaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatggaacctataacaaaattacttc |
22043915 |
T |
|
| Q |
207 |
tatccaatcct |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
22043914 |
tatccaatcct |
22043904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University