View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_584 (Length: 216)
Name: NF11737A_low_584
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_584 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 5 - 216
Target Start/End: Complemental strand, 36514306 - 36514093
Alignment:
| Q |
5 |
atcaagtccgatgaaagtatacccgatttcgatgatgatcaacaagatttccaagaaataaaagatcctcgacaggtatatatgcat----atttcaatt |
100 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36514306 |
atcaggtccaatgaaagtatacccgattccgatgatgatgaacaagattttcaagaaataaaagatcctcgacaggtatatatgcatgcatatttcaatt |
36514207 |
T |
|
| Q |
101 |
tctttctaataatctttttaaaaaatcgataatgcttgcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaacttattcagtca |
200 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36514206 |
tctttctaataatctgtttaaaa--tcgataatgctggcgcaggacgctgctgctactgctcatgcagtaaacaaggttttggaagaacttattcagtca |
36514109 |
T |
|
| Q |
201 |
cctgcatcaaagaaga |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36514108 |
actgcatcaaagaaga |
36514093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 122 - 216
Target Start/End: Original strand, 4233725 - 4233819
Alignment:
| Q |
122 |
aaaatcgataatgcttgcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaacttattcagtcacctgcatcaaagaaga |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4233725 |
aaaatcgataatgcaggcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaatttattcagtcatctgcatcaaagaaga |
4233819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 5 - 101
Target Start/End: Original strand, 4233582 - 4233678
Alignment:
| Q |
5 |
atcaagtccgatgaaagtatacccgatttcgatgatgatcaacaagatttccaagaaataaaagatcctcgacaggtatatatgcatatttcaattt |
101 |
Q |
| |
|
|||| ||||| ||||| |||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4233582 |
atcaggtccggtgaaattatacccgataccgatgatgatgaacaagattttgaagaaataaaagatcctcgacaggtatatatgcatatttgaattt |
4233678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University