View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_585 (Length: 215)
Name: NF11737A_low_585
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_585 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 25696905 - 25697071
Alignment:
| Q |
15 |
atggacatcagacacgacactgacaataataagtagacattggtaataattttcgaaaactggatgtaaccacgtgtgttggtgttcaatctaaagtctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25696905 |
atggacatcagacacgacactgacaataataagtagacattggtaataattttcgaaaactagatgtaaccacgtgtgttggtgttcaatctaaattctt |
25697004 |
T |
|
| Q |
115 |
gctgctacattgatatgaatatatttgatagacaagatcaatttttggactaggattgatgtccatc |
181 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25697005 |
ggtgctacattgatatgaatatatttgatagacaagatcaatttttggactaggattgatgtgcatc |
25697071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University