View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_591 (Length: 215)
Name: NF11737A_low_591
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_591 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 163
Target Start/End: Complemental strand, 40456787 - 40456640
Alignment:
| Q |
16 |
atcacatgtgataccaattagtccgtgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtacatatgtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40456787 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtatatatgtgg |
40456688 |
T |
|
| Q |
116 |
tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40456687 |
tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40456640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 101 - 163
Target Start/End: Complemental strand, 40482148 - 40482086
Alignment:
| Q |
101 |
tctgtacatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
163 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482148 |
tctgtatatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40482086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 40362953 - 40363005
Alignment:
| Q |
16 |
atcacatgtgataccaattagtccgtgaacaaatgacaacaagaaggaatctt |
68 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||| ||| ||||| |||||| |
|
|
| T |
40362953 |
atcaaatgtgataccaattagtccttgcacaaatgataactagaagaaatctt |
40363005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University