View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_592 (Length: 214)
Name: NF11737A_low_592
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_592 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 49 - 189
Target Start/End: Complemental strand, 45616560 - 45616420
Alignment:
| Q |
49 |
ccttcaccttcctccgccattcactcatggcgtttcctttccaccaaaattcgttcctctttctcccaaccaatgatcgttcgaaggaactatctctcga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616560 |
ccttcaccttcctccgccattcactcatggcgtttcctttccaccaaaattcgttcctctttctcccaaccaatgatcgttcgaaggaactatctctcga |
45616461 |
T |
|
| Q |
149 |
gtgtcaaaagcatcattgatcgtagatttcccagagttcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616460 |
gtgtcaaaagcatcattgatcgtagatttcccagagttcat |
45616420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University