View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_595 (Length: 213)
Name: NF11737A_low_595
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_595 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 23 - 205
Target Start/End: Complemental strand, 3544689 - 3544507
Alignment:
| Q |
23 |
aagactgtccaaactgtcacccatgttttctatgcagtcttgtacggctctgtactcccttggcttgatgcctcttgcttttgatatcttctttacaaat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544689 |
aagactgtccaaactgtcacccatgttttctatgcagtcttgtacggctctgtactcccttggcttgatgcctcttgcttttgatatcttctttacaaac |
3544590 |
T |
|
| Q |
123 |
gatgcactcgatcgtgtcctagatatgctcactgatagagcagttatcgttagttgtcgctcgctttggccaatcacactcgc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544589 |
gatgcactcgatcgtgtcctagatatgctcactgatagagcagttatcgttagttgtcgctcgctttggccaatcacactcgc |
3544507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University