View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_598 (Length: 212)
Name: NF11737A_low_598
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_598 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 11571641 - 11571829
Alignment:
| Q |
12 |
ggacatcagacatattgtcgattagaaatgtttatgctagaaacttatccatttgtttattatgttannnnnnn-gggggagtatattttgttaaattaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11571641 |
ggacatcagacatattgtcgattagaaatgtttatgctagaaacttatccatttgtttattatgttatgttttttgggggagtatattttgttaaattaa |
11571740 |
T |
 |
| Q |
111 |
ttactagtaattgctaacttatgtctgtgcgacttggttgacttagttcaactggcaatgctgagatttgttaggttggatattattcg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11571741 |
ttactagtaattgctaacttatgtctgtacgacttggttgacttagttcaactggcaaagctgagatttgttaggttggatatttttcg |
11571829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University