View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_599 (Length: 212)
Name: NF11737A_low_599
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_599 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0642 (2 HSPs) |
 |  |  |
|
| [»] scaffold0345 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold1526 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 24 - 212
Target Start/End: Complemental strand, 54004 - 53816
Alignment:
| Q |
24 |
agtactgaccaaattaccaaagaggatcaaaacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaatacttacttcctc |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54004 |
agtactgacaaaattaccaaagaggatcaaaacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaatacttactttctc |
53905 |
T |
 |
| Q |
124 |
tctaacatcattccaatccggtccttcttctctcacactctattcatacccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53904 |
tctaacatcattccaatccggtccttcttctctcacactctattcatacccatccatgaattcactccagagcggtgagtggcttcgtt |
53816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 15707358 - 15707421
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15707358 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
15707421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 15707440 - 15707481
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
15707440 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
15707481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0642 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: scaffold0642
Description:
Target: scaffold0642; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 4102 - 4165
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4102 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
4165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0642; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 4184 - 4225
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
4184 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
4225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 14014 - 14077
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14014 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
14077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 14096 - 14137
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14096 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
14137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 113 - 176
Target Start/End: Complemental strand, 24967 - 24904
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24967 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
24904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 24885 - 24844
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
24885 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
24844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1526 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: scaffold1526
Description:
Target: scaffold1526; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 1304 - 1249
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattc |
168 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1304 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
1249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1526; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 1217 - 1176
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1217 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
1176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 44495504 - 44495567
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
44495504 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactccattcatacccat |
44495567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 44495589 - 44495627
Alignment:
| Q |
174 |
catccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44495589 |
catccatgaattcactccagatcggtgagtggcttcgtt |
44495627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 3378229 - 3378284
Alignment:
| Q |
113 |
cttacttcctctctaacatcattccaatccggtccttcttctctcacactctattc |
168 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3378229 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
3378284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 3378316 - 3378357
Alignment:
| Q |
171 |
acccatccatgaattcactctagagcggtgagtggcttcgtt |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3378316 |
acccatccatgaattcactccagatcggtgagtggcttcgtt |
3378357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 112
Target Start/End: Original strand, 21221835 - 21221922
Alignment:
| Q |
28 |
ctgaccaaattaccaaagaggatcaa---aacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaata |
112 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| | || |||||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21221835 |
ctgaacaaattaccaaagaggatcaagaaaacactgaaaataggaattatctgtggctgatgatgttgctcctaatagtgatataata |
21221922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University