View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_602 (Length: 210)
Name: NF11737A_low_602
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_602 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 2 - 206
Target Start/End: Complemental strand, 30778612 - 30778408
Alignment:
| Q |
2 |
gtggaagaagacgtctccatgtaatttagtttacggttgttaaagag-tttggaaggacaagaatagtcgtatttttcgacatatagatcaatcgataca |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30778612 |
gtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaaggataagaatagtcgtatttttcgacatataga-caatcgataca |
30778514 |
T |
|
| Q |
101 |
gcaaccggtgaacatcgtgaagttttcttcttttagatggttccaatcgaaaattaacaacttagcctttgattttcatcatcggtggacaagcaaaaat |
200 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30778513 |
acaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaacaacttagcttttgattttcatcatcggtggacaagcaaaaat |
30778414 |
T |
|
| Q |
201 |
tgcaac |
206 |
Q |
| |
|
|||||| |
|
|
| T |
30778413 |
tgcaac |
30778408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University