View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_604 (Length: 209)
Name: NF11737A_low_604
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_604 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 34683225 - 34683397
Alignment:
| Q |
20 |
gagcagaacctgtgtgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaacaaacttgatatt |
119 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683225 |
gagcagaacctctataaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaacaaacttgatatt |
34683324 |
T |
|
| Q |
120 |
ctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683325 |
ctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa |
34683397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 187
Target Start/End: Original strand, 34699458 - 34699611
Alignment:
| Q |
34 |
tgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaaacaaacttgatattctagtcatagagat |
133 |
Q |
| |
|
|||||||||||| ||||||||| | |||| |||||||| | ||| |||||| || || |||| ||| ||||| |||||||||| | | |||| |||||| |
|
|
| T |
34699458 |
tgaaagtgggagccaactctgcgagtgtcttaagagagctatcaattacaatcaataatatgacaaagtcaaagaaacttgatagtttggtcaaagagat |
34699557 |
T |
|
| Q |
134 |
gaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacaca |
187 |
Q |
| |
|
||||| ||| | | |||||| || |||||||||||||| ||| |||||||||| |
|
|
| T |
34699558 |
gaatattgctacacaagagctacaaaatttattaaaatcatattcaaacacaca |
34699611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University