View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_609 (Length: 207)
Name: NF11737A_low_609
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_609 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 20 - 157
Target Start/End: Original strand, 10274651 - 10274788
Alignment:
| Q |
20 |
atgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274651 |
atgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaaaa |
10274750 |
T |
 |
| Q |
120 |
tgtgtcatccaaacttaaccgttcatttacaatttctt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274751 |
tgtgtcatccaaacttaaccgttcatttacaatttctt |
10274788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 10266736 - 10266805
Alignment:
| Q |
20 |
atgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagt |
89 |
Q |
| |
|
||||||| |||||| |||||||| |||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
10266736 |
atgaaatggggtaacgataaaataaagttagataaagaaatgttcagaaaaagccaaagactaatgaagt |
10266805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University