View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_613 (Length: 205)
Name: NF11737A_low_613
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_613 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 29 - 185
Target Start/End: Original strand, 3006563 - 3006720
Alignment:
| Q |
29 |
tcttcataacttgataaa-gaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgctcctccta |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006563 |
tcttcataacttgataaaagaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgctcctccta |
3006662 |
T |
 |
| Q |
128 |
tcaattttatctccacactattcaccatcagaatagccctactagattaagttgttca |
185 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3006663 |
tcaattttatctccacactagtcaccatcagaatagtcctactagattaagttgttca |
3006720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University