View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_64 (Length: 421)
Name: NF11737A_low_64
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 7 - 167
Target Start/End: Complemental strand, 33399989 - 33399827
Alignment:
| Q |
7 |
tgaagagattcatttctat--tcttcaagaatttatgtgaagactacaacgaaaagaagccactcttgttagctccccgcatgagaaatgtcattcgggt |
104 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399989 |
tgaaaagattcatttctatgatcttcaagaatttatgtgaagactacaacgaaaagaagccacatttgttagctccccgcatgagaaatgtcattcgggt |
33399890 |
T |
|
| Q |
105 |
gactagaggaaataggaatttggacaatttatagcacctcaaaaggaaggaatcagctgtcct |
167 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399889 |
gactagaggaaataggaatttggacaagttatagcacctcaaaaggaaggaatcagctgtcct |
33399827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 201 - 360
Target Start/End: Original strand, 32493567 - 32493717
Alignment:
| Q |
201 |
atcaagctgcaaggcattttaggcaaacaagtcaaaaattagcaacaaattataggaagaatgagaaagaatttatggaagatttgcccgaaaattagct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
32493567 |
atcaagctgcaaggcattttaggcaaacaagtcaaaaattagcaccaaattataggaagaatgagaaagaatttatggaagatttgcccgaaacttaggt |
32493666 |
T |
|
| Q |
301 |
agtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggc |
360 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32493667 |
agtggaaactaatcc---------caccaaatgcaacatctcaataatggcgctttcggc |
32493717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 274 - 371
Target Start/End: Complemental strand, 33399795 - 33399698
Alignment:
| Q |
274 |
tatggaagatttgcccgaaaattagctagtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggcaacaccgtctt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399795 |
tatggaagatttgcccgaaaattagctagtggaaactaatcccactaaagacaccaaatgcatcatctcaataatggcgctttcggcaacaccgtctt |
33399698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 124 - 192
Target Start/End: Original strand, 32492827 - 32492895
Alignment:
| Q |
124 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggagcattgtgtcca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32492827 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggggcattgcgtcca |
32492895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 7 - 74
Target Start/End: Original strand, 32492759 - 32492828
Alignment:
| Q |
7 |
tgaagagattcatttctattcttcaagaatt--tatgtgaagactacaacgaaaagaagccactcttgtt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32492759 |
tgaagagattcatttctattcttcaagaatttatatgtgaagactgcaacgaaaagaagccactcttgtt |
32492828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 365 - 402
Target Start/End: Complemental strand, 20287513 - 20287476
Alignment:
| Q |
365 |
ccgtcttgtcacctctgtttgactttcatatttattga |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20287513 |
ccgtcttgtcacctctgtttgactttcatatttattga |
20287476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 405
Target Start/End: Complemental strand, 20286252 - 20286214
Alignment:
| Q |
367 |
gtcttgtcacctctgtttgactttcatatttattgatgt |
405 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
20286252 |
gtcttgtcacctctgtttgacttccatatttgttgatgt |
20286214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 405
Target Start/End: Complemental strand, 6182925 - 6182883
Alignment:
| Q |
363 |
caccgtcttgtcacctctgtttgactttcatatttattgatgt |
405 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
6182925 |
caccgtcttgtcacctctgtttgacttgaatattttttgatgt |
6182883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University