View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_66 (Length: 419)
Name: NF11737A_low_66
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 22 - 412
Target Start/End: Complemental strand, 1212343 - 1211960
Alignment:
| Q |
22 |
tcagctatctgcatcagtgtaaaatattgatatttgccacaagttatatacaaggctaaatgctgagcataattacttctaaacatgataatttatctat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1212343 |
tcagctatctgcatcagtgtaaaatattgatatttgtcacaagttatatacaaggctaaatgctgagcataattacttctaaacatgataatttatctat |
1212244 |
T |
|
| Q |
122 |
aaacaaatatcaacacaaacaataatgaaactctcactcaaaagaaatgactggcttcagtaataagccaaccaacacacaaaagaccgaggattaccaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1212243 |
aaacaaatatcaacacaaacaataatgaaactctcactcaaaagaaatgactggcttcagcaataagccaaccaacacacaaaagaccgaggattatcaa |
1212144 |
T |
|
| Q |
222 |
gaaagcacaaactatgctatttgattcacgtctcattcatatgattagaacaacaaaatagcatttgatataagatgaacaagcaaagcaaattttaaca |
321 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1212143 |
gagagcacaaactatgctatttgattcacgtctcattcatatgattagaacaacaaaatagtatttgatataagatgaa----caaagcaaattttaaca |
1212048 |
T |
|
| Q |
322 |
tttctctcataagagcaaccagttaacaagacaacgtcatattaagaagattattgtctcctgccaaactattgaacgatgatgatgtcca |
412 |
Q |
| |
|
||||||||| |||| ||| || | |||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
1212047 |
tttctctcaaaagaacaaacaatggacaagacaacttcatatt---aagattattgtcacctgccaaactattgaacgatgatgaagtcca |
1211960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University