View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_92 (Length: 389)
Name: NF11737A_low_92
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_92 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0007 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 218 - 389
Target Start/End: Complemental strand, 149871 - 149700
Alignment:
| Q |
218 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
318 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgatga |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgatga |
149700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 27 - 146
Target Start/End: Complemental strand, 150062 - 149943
Alignment:
| Q |
27 |
atttccttcttgacaaggcattggggaatgatcatgagattgtgatgaagttgtctctgatgaagaagcagctaaaggtgatgtttgaggttgttgttga |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
150062 |
atttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttgtctctgatgaagaagcagctaaaggtgttgtttgaggttgttgttga |
149963 |
T |
|
| Q |
127 |
ggtagatttgaaggtgaagg |
146 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
149962 |
ggtagatttgaaggtgaagg |
149943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University