View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_94 (Length: 386)
Name: NF11737A_low_94
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_94 |
 |  |
|
| [»] scaffold0048 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 170 - 382
Target Start/End: Complemental strand, 16343 - 16131
Alignment:
| Q |
170 |
tcacaacatcacactgacgatatcaaccagcacatccctcccataaaacaactacatccaataactaatttgcccagaaatactgctcaacttgaaaagc |
269 |
Q |
| |
|
|||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16343 |
tcacaacatcacactgctgatatcaaccaggacttccctcccataaaacaactacttccaaaatctaatttgcccagaaatacaactcaacttgaaaagc |
16244 |
T |
 |
| Q |
270 |
tggtccatcttcaccggtgcttgtcaagggaggcactgcagtccggagaaccaacattggaggagggcacatgaaaactatcttattgttagctgcctca |
369 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16243 |
tggtccatcttcaccggtgcttgtggagggaggtactgcagtccggagaaccaacatcggaggagggcacatgaaaacgatcctattgttagctgcctca |
16144 |
T |
 |
| Q |
370 |
gtaacaccaaact |
382 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
16143 |
gttacaccaaact |
16131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 16499 - 16413
Alignment:
| Q |
13 |
agatggacatcaagacaacacttaacttttcattcaatggcacaataacattacatcaagtcttatacttaataaaacattaagttg |
99 |
Q |
| |
|
||||| ||| ||||| |||||||||||| |||||||| |||||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
16499 |
agatgaacaccaagataacacttaacttcacattcaatagcacaacaacattacatcaagtcttctacttaaaaaaacattaagttg |
16413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University