View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737_high_27 (Length: 222)
Name: NF11737_high_27
Description: NF11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 81 - 210
Target Start/End: Original strand, 9653250 - 9653377
Alignment:
| Q |
81 |
tattttcaccaagtactactatttagattaactccttaaacacgtcatttacgcaaatgtacattttagattttgtactattctctgtcnnnnnnnngat |
180 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||| |
|
|
| T |
9653250 |
tattttcaccaa--agtactatttagattaacttcttaaacacgtcatttacgcaaatgtactttttagattttgtactattctctctcaaaaaaaagat |
9653347 |
T |
|
| Q |
181 |
tttgaactattcagaaatattattttatca |
210 |
Q |
| |
|
||||||||||||| ||||||| |||||||| |
|
|
| T |
9653348 |
tttgaactattcaaaaatatttttttatca |
9653377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 163
Target Start/End: Original strand, 47708109 - 47708137
Alignment:
| Q |
135 |
aaatgtacattttagattttgtactattc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47708109 |
aaatgtacattttagattttgtactattc |
47708137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University