View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737_low_23 (Length: 242)
Name: NF11737_low_23
Description: NF11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 30841585 - 30841800
Alignment:
| Q |
11 |
cagagaccattgttgggttacgagaggagcccgatggatcatcctcattagactaagagcgatcatacaagtgaattgtacaccccatctttactcaaaa |
110 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841585 |
cagagaccactgttgcgttacgagaggagcccgatggatcatccacattggactcagagcgatcatacaagtgaattgtacaccccatctttactcaaaa |
30841684 |
T |
 |
| Q |
111 |
tcgtaaccttcacttttaaaacaatgtaaaacttctacctcatatttgctaaacaacattaattatnnnnnnntgtggttggtccatttctttatttcct |
210 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30841685 |
tcgtaacctccactttttaaacaatgtaaaacttctacctcatatttgctaaacaacattaattataaaaaaatgtggttggtccatttctttatttcct |
30841784 |
T |
 |
| Q |
211 |
cgtactaggggttatt |
226 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
30841785 |
cgtactagcggttatt |
30841800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University