View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737_low_24 (Length: 239)
Name: NF11737_low_24
Description: NF11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 77 - 222
Target Start/End: Complemental strand, 55322 - 55177
Alignment:
| Q |
77 |
caatagttctataacatttgtgtttactactaccacaatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccat |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55322 |
caatagttctataacatttgtgtttgctactaccacaatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccat |
55223 |
T |
 |
| Q |
177 |
tatctccatttcgctactgtgctgaaatcttcttagctacctgaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55222 |
tatctccatttcgctactgtgctgaaatcttcttagctacctgaag |
55177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 113 - 207
Target Start/End: Complemental strand, 33754761 - 33754667
Alignment:
| Q |
113 |
aatttctattaaatataattgatgatgcattccctacccctcttcttaaatcccatctccccattatctccatttcgctactgtgctgaaatctt |
207 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
33754761 |
aatttatattaaacgtaactgatgatgcattccctacccctcttcttaaatcccatctccccattatatccatttcactactgtgctaaaatctt |
33754667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University