View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737_low_27 (Length: 222)

Name: NF11737_low_27
Description: NF11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737_low_27
NF11737_low_27
[»] chr5 (1 HSPs)
chr5 (81-210)||(9653250-9653377)
[»] chr7 (1 HSPs)
chr7 (135-163)||(47708109-47708137)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 81 - 210
Target Start/End: Original strand, 9653250 - 9653377
Alignment:
81 tattttcaccaagtactactatttagattaactccttaaacacgtcatttacgcaaatgtacattttagattttgtactattctctgtcnnnnnnnngat 180  Q
    ||||||||||||  | ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||        |||    
9653250 tattttcaccaa--agtactatttagattaacttcttaaacacgtcatttacgcaaatgtactttttagattttgtactattctctctcaaaaaaaagat 9653347  T
181 tttgaactattcagaaatattattttatca 210  Q
    ||||||||||||| ||||||| ||||||||    
9653348 tttgaactattcaaaaatatttttttatca 9653377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 163
Target Start/End: Original strand, 47708109 - 47708137
Alignment:
135 aaatgtacattttagattttgtactattc 163  Q
    |||||||||||||||||||||||||||||    
47708109 aaatgtacattttagattttgtactattc 47708137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University