View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11738_high_11 (Length: 249)
Name: NF11738_high_11
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11738_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 115 - 172
Target Start/End: Complemental strand, 29298610 - 29298553
Alignment:
| Q |
115 |
tgtacagcaagtaactcaacttagtctataagtaattgttttttattcagttgatata |
172 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| ||||||| |||||| |||||||| |
|
|
| T |
29298610 |
tgtagagcaagtaactcaacttagcctataagtacttgttttgtattcaattgatata |
29298553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 53611241 - 53611270
Alignment:
| Q |
22 |
tgttagttagttgtggataaatccaactat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53611241 |
tgttagttagttgtggataaatccaactat |
53611270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 242
Target Start/End: Original strand, 53611370 - 53611429
Alignment:
| Q |
185 |
cactcatatctctcacatttaacaata--gagtttcatcattcctttgtagtttcatctc |
242 |
Q |
| |
|
||||||||||||||| ||| || |||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
53611370 |
cactcatatctctcaaattcaataataaagagttttatcattcctttgtagtttcctctc |
53611429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 237
Target Start/End: Complemental strand, 34486451 - 34486393
Alignment:
| Q |
181 |
atatcactcatatctctcacatttaacaat--agagtttcatcattcctttgtagtttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||||||| ||||||||||| |
|
|
| T |
34486451 |
atatcactcatatctctcacatttaataataaagagttttatcattcttttgtagtttc |
34486393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 34391107 - 34391171
Alignment:
| Q |
181 |
atatcactcatatctctcacatttaacaatagag---tttcatcattcctttgtagtttcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||| || |||| || ||| ||||||||||||||||||| |||| |
|
|
| T |
34391107 |
atatcactcatatctctcacattcaataataaagtgtttttatcattcctttgtagtttcctctc |
34391171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 28027966 - 28027995
Alignment:
| Q |
22 |
tgttagttagttgtggataaatccaactat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28027966 |
tgttagttagttgtggataaatccaactat |
28027995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 31477967 - 31477996
Alignment:
| Q |
22 |
tgttagttagttgtggataaatccaactat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31477967 |
tgttagttagttgtggataaatccaactat |
31477996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University