View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11738_low_16 (Length: 214)
Name: NF11738_low_16
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11738_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 47 - 196
Target Start/End: Original strand, 43367425 - 43367580
Alignment:
| Q |
47 |
aatggcattattttttgacttagtttgtacaaaactgtcaaggattgtaagtaagatgtctaggttcagctaacattcactgacgcacacatcatagata |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367425 |
aatggcattattttttgacttagtttgtacaaaactgtcaaggattgtaagtaagatgtctaggttcagctaacattcactgacgcacacatcatagata |
43367524 |
T |
|
| Q |
147 |
gat----agatgctaata--agtaaaaaataatattgcagaatgggttgacgtatg |
196 |
Q |
| |
|
||| | | || || | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367525 |
gatgctaataagcaaaaaatagtaaaaaataatattgcagaatgggttgacgtatg |
43367580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 43367333 - 43367377
Alignment:
| Q |
1 |
cactgtaaattgttcttataacttac-aagacatgattgtgcaat |
44 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43367333 |
cactgtaaattgttcttataacttacaaagacatgattgtgcaat |
43367377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University