View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11738_low_3 (Length: 586)
Name: NF11738_low_3
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11738_low_3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 364 - 586
Target Start/End: Original strand, 38128808 - 38129040
Alignment:
| Q |
364 |
actgattttatcctcattgactgcagatggcaagggaaaaactgctacaaatgaagcaagttataacaatgtgcttgaaagagggtttctaattggacat |
463 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38128808 |
actgattttatcgtcattgactgcagatggcaaggggaaaactgctacaactgaagcaagttataacaatgtgcttgaaagagggtttctaattggacat |
38128907 |
T |
 |
| Q |
464 |
gaatatttctgatgattccttacaagatac-------------aagtaagcccccttaatttcaccataaccttggcaccggtgccattatagttttaca |
550 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38128908 |
g---atttctgatgattccttacaagatacaaactttgcctgtaagtaagcccccttaatttcaccataaccttggcaccggtgccattatagttttaca |
38129004 |
T |
 |
| Q |
551 |
cgtactaatattatccccgaacccctcttttaagtg |
586 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129005 |
cgtactaatattatccccgaacccctcttttaagtg |
38129040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 344 - 495
Target Start/End: Complemental strand, 38309534 - 38309386
Alignment:
| Q |
344 |
agcattgtgtatcacgtaggactgattttatcctcattgactgcagatggcaagggaaaaactgctacaaatgaagcaagttataacaatgtgcttgaaa |
443 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
38309534 |
agcattgtgtatcgcgtagaactgattttatcctcattgactgcagatggcaaggggaaaactactacaactgaagcaagttataacgatgtgcttgaaa |
38309435 |
T |
 |
| Q |
444 |
gagggtttctaattggacatgaatatttctgatgattccttacaagatacaa |
495 |
Q |
| |
|
|||||| ||||| ||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
38309434 |
gagggtatctaaatggacgtg---atttctgatgattccttacaagttacaa |
38309386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University