View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11738_low_4 (Length: 582)
Name: NF11738_low_4
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11738_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 1e-73; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 210 - 383
Target Start/End: Original strand, 43366961 - 43367130
Alignment:
| Q |
210 |
ttactttcaacacagtctctaacactctgttttttcagatttcataattaaaaccaaataggagggatgcgtaaagaaatagtcgaaaatattggtttta |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43366961 |
ttactttcaacacagtctctaacactctgttttttcagatttcataattcaaactaaatatgagggatgcgtaaagaaattgtcgaaaatattggtttta |
43367060 |
T |
 |
| Q |
310 |
agcccatggactgcgagttaaacgggttgatgtgggcctcgagtcgacccatatatatacccagctctactatt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43367061 |
agcccatggactgcgagttaaacgggttgatgtgggcctcgagtcgaccc----atatacccagctctactatt |
43367130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 43366765 - 43366867
Alignment:
| Q |
8 |
gcagagaagaagtgattcgttcgtgaagaaatgagagaaacagaagaaaacaagggttagagataagtatgaaattcagttatgggccaaactataaatg |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366765 |
gcagagaagatgtgattcgttcgtgaagaaatgagagaaacagaacaaaacaagggttagagataagtatgaaattcagttatgggccaaactataaatg |
43366864 |
T |
 |
| Q |
108 |
gac |
110 |
Q |
| |
|
||| |
|
|
| T |
43366865 |
gac |
43366867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 401 - 463
Target Start/End: Original strand, 43367191 - 43367253
Alignment:
| Q |
401 |
acatgggatgggatttggaaatgagtagtaattggatgcagtagttttttagcactgtaaaat |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43367191 |
acatgggatgggatttggaaatgagtagtaattggatgcagtagtttttgagcactgtaaaat |
43367253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 170
Target Start/End: Original strand, 43366902 - 43366930
Alignment:
| Q |
142 |
taatttcttataccaccctacatcatttt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43366902 |
taatttcttataccaccctacatcatttt |
43366930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University