View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11738_low_9 (Length: 379)
Name: NF11738_low_9
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11738_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 31 - 139
Target Start/End: Complemental strand, 28942425 - 28942317
Alignment:
| Q |
31 |
ttattcggtacgacgttgtttgatggtacctcaattacaaccggatgtggagatgaaccagatgatgattctgattttacttacgtctctgccattgtta |
130 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28942425 |
ttattcggtacgacgttgtttgatgatacctcaattacaaccagatgtggagatgaaccagatgatgattctgattttacttgtgtctctgccattgtta |
28942326 |
T |
|
| Q |
131 |
ttggaagaa |
139 |
Q |
| |
|
||||||||| |
|
|
| T |
28942325 |
ttggaagaa |
28942317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 289 - 368
Target Start/End: Complemental strand, 28940874 - 28940795
Alignment:
| Q |
289 |
gcgacatgcaacatgctaatatgaagcttctggttatagttttataatgaccgtgattccaaacacattgatagtttcat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940874 |
gcgacatgcaacatgctaatatgaagcttctggttatagttttataatgaccgtgattccaaacacattgatagtttcat |
28940795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 247 - 294
Target Start/End: Complemental strand, 28940931 - 28940884
Alignment:
| Q |
247 |
taattcagacttatcaataaaacctggaaaatgctagatccagcgaca |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
28940931 |
taattcagacttatcaataaaacttggaaaatgctagaaccagcgaca |
28940884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University