View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11739_high_12 (Length: 254)
Name: NF11739_high_12
Description: NF11739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11739_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 39 - 242
Target Start/End: Original strand, 24129777 - 24129980
Alignment:
| Q |
39 |
ggtggaaactgcttgactcttttgaaaatgtttcaaggagtgaagctttgtaactgctatagttggaataggttaaggactaaagatctgtaactgctat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24129777 |
ggtggaaactgcttgactcttttgaaaatgtttcaaggagtgaagctttgtaactgctatagttggaataggttaaggactaaagatctgtaactgctat |
24129876 |
T |
 |
| Q |
139 |
agtggattaggttaatctggtagccacatattagtcaattttaagtgtaagccgaatttgacagcaataatggtaatactatcagtcttgattttgatct |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24129877 |
agtggattaggttaatctggttgccacatattagtcaattttaagtgtaagccgaatttgacagcaataatggtaatactatcagtcttgattttgatct |
24129976 |
T |
 |
| Q |
239 |
ctgc |
242 |
Q |
| |
|
|||| |
|
|
| T |
24129977 |
ctgc |
24129980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 39 - 210
Target Start/End: Original strand, 24147793 - 24147961
Alignment:
| Q |
39 |
ggtggaaactgcttgactcttttgaaaatgtttcaaggagtgaagctttgtaactgctatagttggaataggttaaggactaaagatctgtaactgctat |
138 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||| ||| | ||||||| ||| |
|
|
| T |
24147793 |
ggtggaaactgcttcactcttttgaaaatgtttcagggaatgaagctttgtaactgctatag-tggaataggttaaggactgaagctatgtaacttctac |
24147891 |
T |
 |
| Q |
139 |
agtggattaggttaatctggtagccacatattagtcaattttaagtgtaagccgaatttgacagcaataatg |
210 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
24147892 |
agtggactaggttaatcttcttagcacatattagtcaattttaa--gtaaaccgaatttgacaacaataatg |
24147961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University