View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11739_high_14 (Length: 251)
Name: NF11739_high_14
Description: NF11739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11739_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 41022888 - 41022782
Alignment:
| Q |
1 |
ccacttggctgtttgtgttgtaaaagtaaaactaaataatccagggagtgtctaaaatcgaacatgttaacatacttgacctattgagcactgtcaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41022888 |
ccacttggctgtttgtgttgtaaaagtaaaactaaataatgcagggagtgtctaaaatcgaacatgttaacatacttgacctattgagcactgtcaatct |
41022789 |
T |
|
| Q |
101 |
gattttt |
107 |
Q |
| |
|
||||||| |
|
|
| T |
41022788 |
gattttt |
41022782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University