View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11739_high_7 (Length: 321)
Name: NF11739_high_7
Description: NF11739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11739_high_7 |
 |  |
|
| [»] scaffold0140 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 73 - 227
Target Start/End: Original strand, 33326 - 33481
Alignment:
| Q |
73 |
gctctaaaatcatatatcatgttttggctaaaccaattagaatcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatgt-caaaaa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
33326 |
gctctaaaatcatatatcatgttttggctaaaccaattagactcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatatacaaaaa |
33425 |
T |
 |
| Q |
172 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33426 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
33481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 248 - 299
Target Start/End: Original strand, 33515 - 33566
Alignment:
| Q |
248 |
caataaaatgagaaactccatatcacattaaagaaagtggaaccataaatat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33515 |
caataaaatgagaaactccatatcacattaaagaaagtggaaccataaatat |
33566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 33252 - 33287
Alignment:
| Q |
1 |
tagaacagagaggatacaaagcgaccttaactagtg |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252 |
tagaacagagaggatacaaagcgaccttaactagtg |
33287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University