View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11739_low_11 (Length: 301)

Name: NF11739_low_11
Description: NF11739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11739_low_11
NF11739_low_11
[»] chr2 (5 HSPs)
chr2 (7-292)||(14163848-14164135)
chr2 (169-272)||(2176943-2177046)
chr2 (83-166)||(79356-79441)
chr2 (83-166)||(44939811-44939896)
chr2 (59-144)||(6469071-6469158)
[»] chr3 (12 HSPs)
chr3 (27-285)||(37835721-37835981)
chr3 (26-164)||(33980601-33980740)
chr3 (26-163)||(15372298-15372437)
chr3 (207-293)||(25449436-25449523)
chr3 (208-285)||(25617694-25617771)
chr3 (82-165)||(40969796-40969881)
chr3 (27-160)||(19653175-19653310)
chr3 (40-164)||(25617520-25617646)
chr3 (231-293)||(33980466-33980528)
chr3 (208-285)||(14609019-14609093)
chr3 (208-293)||(15372486-15372571)
chr3 (83-165)||(53050540-53050624)
[»] chr6 (6 HSPs)
chr6 (26-164)||(17714012-17714152)
chr6 (27-164)||(33754589-33754728)
chr6 (231-293)||(26444259-26444321)
chr6 (83-166)||(26710814-26710899)
chr6 (83-166)||(3490314-3490399)
chr6 (83-166)||(31933831-31933916)
[»] chr1 (9 HSPs)
chr1 (26-164)||(31458838-31458978)
chr1 (26-164)||(51128502-51128642)
chr1 (27-164)||(36193216-36193355)
chr1 (26-164)||(32641454-32641594)
chr1 (231-293)||(13383447-13383507)
chr1 (77-164)||(35368399-35368488)
chr1 (208-265)||(6333232-6333289)
chr1 (214-293)||(32641325-32641404)
chr1 (234-285)||(51128374-51128425)
[»] chr5 (5 HSPs)
chr5 (26-164)||(10468809-10468949)
chr5 (26-164)||(28639173-28639313)
chr5 (231-293)||(42073168-42073230)
chr5 (232-293)||(28639388-28639449)
chr5 (27-164)||(26501413-26501553)
[»] chr8 (6 HSPs)
chr8 (83-166)||(41692234-41692319)
chr8 (26-164)||(38891782-38891922)
chr8 (230-293)||(17859202-17859265)
chr8 (208-293)||(1828702-1828787)
chr8 (208-293)||(1863147-1863232)
chr8 (83-166)||(24732721-24732806)
[»] chr4 (11 HSPs)
chr4 (27-164)||(10009607-10009746)
chr4 (26-164)||(7446343-7446484)
chr4 (82-165)||(19836717-19836802)
chr4 (77-164)||(26017663-26017752)
chr4 (208-293)||(38654564-38654649)
chr4 (29-174)||(25459444-25459591)
chr4 (208-293)||(7446207-7446292)
chr4 (208-285)||(31110831-31110908)
chr4 (85-144)||(38948353-38948414)
chr4 (94-175)||(8933217-8933298)
chr4 (232-293)||(26017828-26017889)
[»] scaffold0394 (1 HSPs)
scaffold0394 (26-166)||(5204-5346)
[»] chr7 (4 HSPs)
chr7 (83-166)||(39295847-39295932)
chr7 (231-293)||(21431558-21431620)
chr7 (231-293)||(44593933-44593995)
chr7 (233-293)||(25754823-25754884)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 7 - 292
Target Start/End: Complemental strand, 14164135 - 14163848
Alignment:
7 gaaccatagattgtttaccaacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt-- 104  Q
    |||||||| |||||||||||||||| ||| |||||| ||||| |||||||||||| |||||||||  ||  |||||||||||||||||||||||||||      
14164135 gaaccatatattgtttaccaacaaaaccattacgactgtgcaattagtggagaagatgaagatgtattcttttcggtggttgaaagcaaaaaatgtgtgc 14164036  T
105 tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatgattatttttaatttataacattactcttaaggactact 204  Q
    |||||||||||| || |||||||||||||||||||||||| |||||||||||| ||| || | |||||||| |||||||||||||||||| ||||||  |    
14164035 tttccctttggttatcatatgtggtggcagaatccccttgcatgtttggggattggccgaagtttatttttcatttataacattactcttcaggactttt 14163936  T
205 taatgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatataatctcattttagcttgt 292  Q
    | |||||| |||||||| ||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||    
14163935 tgatgtaactttgttttgcttctctttgcactcattgtgctagggagcaaaactttttatttgttaatataatctcattttagcttgt 14163848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 169 - 272
Target Start/End: Complemental strand, 2177046 - 2176943
Alignment:
169 tatttttaatttataacattactcttaaggactacttaatgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgt 268  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||    
2177046 tatttttaatttataacattactcttcaggactacttaatgtaattttgttttgcttctctttgcactccttgtgctatggagcaaaacttcttgtttgt 2176947  T
269 taat 272  Q
    ||||    
2176946 taat 2176943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 83 - 166
Target Start/End: Complemental strand, 79441 - 79356
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||| ||||||||||||||||  ||||| |||||| || || |||||||||||  ||||||||  ||||| ||||| ||||||||    
79441 tggttaaaagcaaaaaatgtgtgctttccttttggttatcatttgtggtggcagcgtccccttgcttgtttagggattggctgatg 79356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 83 - 166
Target Start/End: Complemental strand, 44939896 - 44939811
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| |||| | || || ||||||||||| |||||||||   |||| ||||| ||||||||    
44939896 tggttgaaagcaaaaaatgtgtgctttccttttgattatcatttgtggtggcagcatccccttgctggtttagggattggctgatg 44939811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 144
Target Start/End: Complemental strand, 6469158 - 6469071
Alignment:
59 aaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttg 144  Q
    ||||| |||||||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || || | ||||||||| |||||||||    
6469158 aaggttaagatgtattctcttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcatttatggtggcagcatccccttg 6469071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 27 - 285
Target Start/End: Original strand, 37835721 - 37835981
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagc--aaaaaatgtgttttccctttggtcattatat 124  Q
    ||||||||||||||||||||||  || || | ||||| |||||||  || ||| |||||||||||||  |||| || |||||||  ||||||||| ||||    
37835721 acaaagccaatacgacggtgcaactattgaaaaaggttaagatgtattctcttgggtggttgaaagctaaaaatatatgttttctttttggtcatcatat 37835820  T
125 gtggtggcagaatccccttgaatgtttggggataggctgatg-attatttttaatttataacattactcttaaggactacttaatgtaattttgttttac 223  Q
    |||||||||  |||||||||  ||||||| ||| | ||||||  |||||||| ||||||| |   ||| || ||||||  || |||||| |||||||| |    
37835821 gtggtggcaacatccccttgtttgtttggagattgactgatgttttatttttcatttatagccacactattcaggactgtttgatgtaactttgttttgc 37835920  T
224 ttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcatttt 285  Q
    |||| || ||||||||||||||| ||||||||||| ||| |||||||||||| ||||||||||    
37835921 ttct-ttagcactccttgtgctagggagcaaaactattt-tttgttaatatatatctcatttt 37835981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 33980740 - 33980601
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt-tttccctttggtcattatat 124  Q
    |||||||||||||||| ||||||| |  |||| ||||| |||||||  || ||||| ||||||||||| ||||||||||  || ||||| || || || |    
33980740 aacaaagccaatacgatggtgcagcttttggaaaaggttaagatgtattctcttcgttggttgaaagctaaaaatgtgtgctttccttttgttatcattt 33980641  T
125 gtggtggcagaatccccttgaatgtttggggataggctga 164  Q
     ||||||||| |||||||||  ||||| ||||||||||||    
33980640 atggtggcagcatccccttgtttgtttagggataggctga 33980601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 15372298 - 15372437
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    ||||||| |||||||||||||||| |  |||| ||||| |||||||  || ||||  ||||||||||| ||||||||||  ||||| |||||| || ||     
15372298 aacaaagtcaatacgacggtgcagcttttggaaaaggttaagatgtattctcttcattggttgaaagctaaaaatgtgtgctttccttttggttatcatt 15372397  T
124 tgtggtggcagaatccccttgaatgtttggggataggctg 163  Q
    | ||||||||| ||||| |||  ||||| |||||||||||    
15372398 tatggtggcagcatccctttgtttgtttagggataggctg 15372437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 207 - 293
Target Start/End: Complemental strand, 25449523 - 25449436
Alignment:
207 atgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    |||||| |||||||| ||||| |   |||||||||||||| ||||||||||| |||  ||||||||||| ||||||||||| ||||||    
25449523 atgtaactttgttttgcttctttagacactccttgtgctagggagcaaaactattttattgttaatatatatctcattttaacttgtt 25449436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 285
Target Start/End: Original strand, 25617694 - 25617771
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcatttt 285  Q
    ||||| |||||||| |||||   |||||||||||||||| ||||||| |||||||| ||||||||||| ||||||||||    
25617694 tgtaactttgttttgcttcttaatgcactccttgtgctagggagcaagactttttg-ttgttaatatatatctcatttt 25617771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 82 - 165
Target Start/End: Complemental strand, 40969881 - 40969796
Alignment:
82 gtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgat 165  Q
    |||||||||||||||||||||||  ||||| |||||| || |||||||||||||   |||| |||  ||||||||||| |||||||    
40969881 gtggttgaaagcaaaaaatgtgtgctttccatttggttatcatatgtggtggcaacgtccctttgcttgtttggggattggctgat 40969796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 160
Target Start/End: Original strand, 19653175 - 19653310
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatat 124  Q
    ||||||||||||||| ||||||| |  | || ||||| ||| |||  || ||||  ||||||||||| ||||||||||  ||||| |||||| || || |    
19653175 acaaagccaatacgatggtgcagcttttagaaaaggttaagttgtattctcttcattggttgaaagctaaaaatgtgtgctttccttttggttatcattt 19653274  T
125 gtggtggcagaatccccttgaatgtttggggatagg 160  Q
     |||||||| ||||||||||  ||||| ||||||||    
19653275 atggtggcaaaatccccttgcttgtttagggatagg 19653310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 40 - 164
Target Start/End: Original strand, 25617520 - 25617646
Alignment:
40 gacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaat 137  Q
    |||||||||| |  |||| ||||| |||||||  || ||||| ||||||||||| ||||||||||  ||| | |||||| || || | ||||||||| ||    
25617520 gacggtgcagcttttggaaaaggttaagatgtattctcttcgttggttgaaagctaaaaatgtgtgcttttcttttggttatcatttatggtggcagcat 25617619  T
138 ccccttgaatgtttggggataggctga 164  Q
    ||| |||  ||||| ||||||||||||    
25617620 ccctttgtttgtttagggataggctga 25617646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 293
Target Start/End: Complemental strand, 33980528 - 33980466
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||||  |||||| | |||||| ||||||||||| ||||||||||||||||||    
33980528 tgcactccttgtgctagagagcaagattttttg-ttgttaatatatatctcattttagcttgtt 33980466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 285
Target Start/End: Original strand, 14609019 - 14609093
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatataatctcatttt 285  Q
    |||||||||||| | ||||| | ||| ||||||||||||||||||| |  ||||| ||||||||||| ||||||||||    
14609019 tgtaattttgttctgcttctttatgccctccttgtgctatggagcaga--tttttttttgttaatat-atctcatttt 14609093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 293
Target Start/End: Original strand, 15372486 - 15372571
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||| ||||||||  ||||  |||||||||||||||||  |||||| |||| ||| ||||||||||| |||||||||| |||||||    
15372486 tgtaactttgttttgattcttattgcactccttgtgctagagagcaagacttattg-ttgttaatatatatctcattttggcttgtt 15372571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 83 - 165
Target Start/End: Complemental strand, 53050624 - 53050540
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgat 165  Q
    ||||||||||||||||||||||  ||| | |||||| || |||| ||||||||  ||||| |||  ||||||||||| |||||||    
53050624 tggttgaaagcaaaaaatgtgtgtttttcatttggttatcatatatggtggcaacatccctttgcttgtttggggattggctgat 53050540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 164
Target Start/End: Original strand, 17714012 - 17714152
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||||||| ||||||| |  |||| ||||| ||| ||| ||| ||||||||||||||||| ||||||||||  ||||| |||||| || ||     
17714012 aacaaagccaatacgatggtgcagcttttggaaaaggttaagttgtactctcttcggtggttgaaagctaaaaatgtgtgctttccttttggttatcatt 17714111  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | ||||||||| ||||||| || |||||  |||||||||||    
17714112 tatggtggcagcatcccctagattgtttaaggataggctga 17714152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 27 - 164
Target Start/End: Original strand, 33754589 - 33754728
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatat 124  Q
    ||||||||||||||| ||||||| |  | || ||||| ||| |||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || || |    
33754589 acaaagccaatacgatggtgcagcttttagaaaaggttaagttgtattctcttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcattt 33754688  T
125 gtggtggcagaatccccttgaatgtttggggataggctga 164  Q
     |||||||| ||||||||||  ||||| ||||||||||||    
33754689 atggtggcaaaatccccttgcttgtttagggataggctga 33754728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 293
Target Start/End: Original strand, 26444259 - 26444321
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||||  ||||||||||||||| || |||||||| ||||||||||||||||||    
26444259 tgcactccttgtgctagagagcaaaactttttg-ttattaatatatatctcattttagcttgtt 26444321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 83 - 166
Target Start/End: Complemental strand, 26710899 - 26710814
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| |||||| || || |||||||||||  ||||||||  ||||| ||||| ||||||||    
26710899 tggttgaaagcaaaaaatgtgtgctttccttttggttatcatttgtggtggcagcgtccccttgcttgtttagggattggctgatg 26710814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 83 - 166
Target Start/End: Original strand, 3490314 - 3490399
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| |||||| |  ||||||||||||||  |||||||   ||||||||||| | ||||||    
3490314 tggttgaaagcaaaaaatgtgtgctttccttttggttaccatatgtggtggcagcgtccccttacttgtttggggattgactgatg 3490399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 83 - 166
Target Start/End: Complemental strand, 31933916 - 31933831
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| |||||| |  ||||||||||||||  |||||||   ||||||||||| | ||||||    
31933916 tggttgaaagcaaaaaatgtgtgctttccttttggttaccatatgtggtggcagcgtccccttacttgtttggggattgactgatg 31933831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 31458978 - 31458838
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||||||| ||||||| |  |||| ||||| |||||||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || ||     
31458978 aacaaagccaatacgatggtgcagcttttggaaaaggttaagatgtattctcttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcatt 31458879  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | ||||||||| |||||||||  ||||| ||||||||||||    
31458878 tatggtggcagcatccccttgtttgtttagggataggctga 31458838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 51128642 - 51128502
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    ||||||||||||||||||||||||||  |||| ||||| |||||||  || ||||| ||||||||| | ||||||||||  ||| | |||||| || ||     
51128642 aacaaagccaatacgacggtgcagtttttggaaaaggttaagatgtattctcttcgttggttgaaaactaaaaatgtgtgcttttcttttggttatcatt 51128543  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | ||||||||| ||||| |||  ||||| ||||||||||||    
51128542 tatggtggcagcatccctttgtttgtttagggataggctga 51128502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 27 - 164
Target Start/End: Original strand, 36193216 - 36193355
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatat 124  Q
    ||||||||||||||  ||||||  |  |||| ||||| ||| ||||||| ||||| ||||||||||| ||||||||||  ||| | |||||| || || |    
36193216 acaaagccaatacggtggtgcaactcttggaaaaggttaagttgttctctcttcgttggttgaaagctaaaaatgtgtgcttttcttttggttatcattt 36193315  T
125 gtggtggcagaatccccttgaatgtttggggataggctga 164  Q
     ||||||||| |||||||||  ||||| ||||||||||||    
36193316 atggtggcagcatccccttgtttgtttagggataggctga 36193355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 32641594 - 32641454
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||  ||| | ||||| |  |||| ||||| ||||||| ||| ||||| ||||||||||| ||||||||||  ||||| |||||| || ||     
32641594 aacaaagccaactcgatgatgcagcttttggaaaaggttaagatgtactctcttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcatt 32641495  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | ||||||||| ||||||||   ||||| ||||||||||||    
32641494 tatggtggcagcatccccttctgtgtttagggataggctga 32641454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 293
Target Start/End: Complemental strand, 13383507 - 13383447
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatataatctcattttagcttgtt 293  Q
    |||||||||| ||||| |||||||||||||||| |||||||||| |||||||||| |||||||    
13383507 tgcactccttatgctagggagcaaaactttttg-ttgttaatat-atctcattttggcttgtt 13383447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 77 - 164
Target Start/End: Original strand, 35368399 - 35368488
Alignment:
77 cttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    ||||| ||||||||||| ||||||||||  ||||| |||||| || || | ||||||||| |||||||||  ||||| ||||||||||||    
35368399 cttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcatttatggtggcagcatccccttgtttgtttagggataggctga 35368488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 265
Target Start/End: Original strand, 6333232 - 6333289
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtt 265  Q
    ||||||||||||||   ||| || ||||||||||||||| ||| ||||||||||||||    
6333232 tgtaattttgttttgtctcttttggcactccttgtgctagggatcaaaactttttgtt 6333289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 293
Target Start/End: Complemental strand, 32641404 - 32641325
Alignment:
214 tttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    |||||||| |||||   |||||||||||||||   |||||| |||||||| ||||||||||| |||||||||| |||||||    
32641404 tttgttttgcttcttaatgcactccttgtgcttgagagcaagactttttg-ttgttaatatatatctcattttggcttgtt 32641325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 285
Target Start/End: Complemental strand, 51128425 - 51128374
Alignment:
234 actccttgtgctatggagcaaaactttttgtttgttaatata-atctcatttt 285  Q
    ||||||||||||| ||||||| |||||||| ||||||||||| ||||||||||    
51128425 actccttgtgctagggagcaagactttttg-ttgttaatatatatctcatttt 51128374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 10468949 - 10468809
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||||||||||||||| |  |||| ||||| ||| |||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || ||     
10468949 aacaaagccaatacgacggtgcagcttttggaaaaggttaagttgtattctcttcgttggttgaaagctaaaaatgtgtgctttccttttggttatcatt 10468850  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | |||||| || |||||||||  ||||| ||||||||||||    
10468849 tatggtggaagcatccccttgtttgtttagggataggctga 10468809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 26 - 164
Target Start/End: Original strand, 28639173 - 28639313
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||||||||| ||||| |  |||| ||||| || ||||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || ||     
28639173 aacaaagccaatacgacgatgcagcttttggaaaaggttaaaatgtattctcttcgttggttgaaagccaaaaatgtgtgctttccttttggttatcatt 28639272  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | ||||||||| |||||||||  ||||| ||||||||||||    
28639273 tatggtggcagcatccccttgtttgtttagggataggctga 28639313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 293
Target Start/End: Complemental strand, 42073230 - 42073168
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||||  |||||||||||||||||| |||||||| ||||||||||||||||||    
42073230 tgcactccttgtgctagagagcaaaactttttgttt-ttaatatatatctcattttagcttgtt 42073168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 293
Target Start/End: Original strand, 28639388 - 28639449
Alignment:
232 gcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||| ||||||| |||||||| ||| ||||||| |||||||||| |||||||    
28639388 gcactccttgtgctagggagcaagactttttg-ttgctaatatatatctcattttggcttgtt 28639449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 164
Target Start/End: Complemental strand, 26501553 - 26501413
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatat 124  Q
    ||||||||||||||  ||||||| |  |||| ||||| ||| |||  || ||||| ||||||||||| ||||||||||  | ||| |||||| || || |    
26501553 acaaagccaatacggtggtgcagctcttggaaaaggttaagttgtattctcttcgttggttgaaagctaaaaatgtgtgctctccttttggttatcattt 26501454  T
125 gtggtggcagaat-ccccttgaatgtttggggataggctga 164  Q
     ||||||||| || |||||||  ||||| ||||||||||||    
26501453 atggtggcagcatcccccttgtttgtttagggataggctga 26501413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 83 - 166
Target Start/End: Original strand, 41692234 - 41692319
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| | |||| || ||||||||||||||  ||||||||| ||||||||||| ||||||||    
41692234 tggttgaaagcaaaaaatgtgtgctttccttatggttatcatatgtggtggcagcgtccccttgactgtttggggattggctgatg 41692319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 26 - 164
Target Start/End: Original strand, 38891782 - 38891922
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattata 123  Q
    |||||||||||||||||||||||  |  |||| ||||| |||||||  || ||||| ||||||||||| ||||||||||  |||||  ||||| || ||     
38891782 aacaaagccaatacgacggtgcaacttttggaaaaggttaagatgtattctcttcgttggttgaaagctaaaaatgtgtgctttcctcttggttatcatt 38891881  T
124 tgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    | |||| |||| |||||||||  ||||| ||||||||||||    
38891882 tatggtagcagcatccccttgtttgtttagggataggctga 38891922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 230 - 293
Target Start/End: Original strand, 17859202 - 17859265
Alignment:
230 ttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||||| ||||||| |||||||| ||||||||||| |||||||||| |||||||    
17859202 ttgcactccttgtgctagggagcaagactttttg-ttgttaatatatatctcattttggcttgtt 17859265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 293
Target Start/End: Original strand, 1828702 - 1828787
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||   ||| |||||||||||| ||||| |||||||||| |||  |||||||||||| |||||||||| |||||||    
1828702 tgtaattttgttttgtctctttttgcactccttatgctagggagcaaaac-tttgatttgttaatatatatctcattttggcttgtt 1828787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 293
Target Start/End: Original strand, 1863147 - 1863232
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||||||||||||   ||| |||||||||||| ||||| |||||||||| |||  |||||||||||| |||||||||| |||||||    
1863147 tgtaattttgttttgtctctttttgcactccttatgctagggagcaaaac-tttgatttgttaatatatatctcattttggcttgtt 1863232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 83 - 166
Target Start/End: Complemental strand, 24732806 - 24732721
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||||||||||||||||  ||||| |||||| |  ||||||||||||||  ||||||||  ||||||| ||| ||||||||    
24732806 tggttgaaagcaaaaaatgtgtgctttccttttggttaccatatgtggtggcagcgtccccttgcttgtttggagattggctgatg 24732721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 164
Target Start/End: Original strand, 10009607 - 10009746
Alignment:
27 acaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatat 124  Q
    ||||||||||||||  ||||||| |   ||| ||||| ||| |||  || ||||| ||||||||||| ||||||||||  ||||| |||||| || || |    
10009607 acaaagccaatacggtggtgcagctctaggaaaaggttaagttgtattctcttcgttggttgaaagctaaaaatgtgtgttttccttttggttatcattt 10009706  T
125 gtggtggcagaatccccttgaatgtttggggataggctga 164  Q
     ||||||||| |||||||||  ||||| ||||||||||||    
10009707 atggtggcagcatccccttgtttgtttagggataggctga 10009746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 7446484 - 7446343
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaa-gatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattat 122  Q
    |||||||||||||||| ||||||| |  |||| || || || |||||  || ||||| ||||||||||| |||||| |||  ||||| |||||| || ||    
7446484 aacaaagccaatacgatggtgcagcttttggaaaatgttaaagatgtattctcttcgttggttgaaagctaaaaatatgtgctttccttttggttatcat 7446385  T
123 atgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
     | ||||||||| |||||||||  ||||| ||||||||||||    
7446384 ttatggtggcagcatccccttgtttgtttagggataggctga 7446343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 82 - 165
Target Start/End: Complemental strand, 19836802 - 19836717
Alignment:
82 gtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgat 165  Q
    |||||||||||||||||||||||  ||||| |||||| || |||||||||||||   |||| |||  ||||||||||| |||||||    
19836802 gtggttgaaagcaaaaaatgtgtgctttccatttggttatcatatgtggtggcaacgtccctttgcttgtttggggattggctgat 19836717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 77 - 164
Target Start/End: Original strand, 26017663 - 26017752
Alignment:
77 cttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctga 164  Q
    ||||| ||||||||||| ||||||||||  ||||| |||||| || || | ||||||||| |||||||||  ||||| ||||||||||||    
26017663 cttcgttggttgaaagccaaaaatgtgtgttttccttttggttatcatttatggtggcagcatccccttgtttgtttagggataggctga 26017752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 293
Target Start/End: Complemental strand, 38654649 - 38654564
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||| |||||||| |||||   ||||||||||||||||  ||||||||||||||||||  ||||||| |||||||||| |||||||    
38654649 tgtaactttgttttgcttcttaatgcactccttgtgctagagagcaaaactttttgttt-ataatatatatctcattttggcttgtt 38654564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 174
Target Start/End: Original strand, 25459444 - 25459591
Alignment:
29 aaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgt 126  Q
    |||| ||| ||||| |||||  || |||| ||||||||||| |  || ||||| |||||||||||  ||||||| |  ||||| |||| | || ||||||    
25459444 aaagtcaacacgaccgtgcatctattggaaaaggtgaagatatattctcttcgatggttgaaagcttaaaatgtatgctttccttttgattatcatatgt 25459543  T
127 ggtggcagaatccccttgaatgtttggggataggctgatgattatttt 174  Q
    |||||||||| |||||||  ||||||||||| |  ||||| |||||||    
25459544 ggtggcagaacccccttgcttgtttggggattgagtgatgtttatttt 25459591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 293
Target Start/End: Complemental strand, 7446292 - 7446207
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    ||||| |||||||| | ||| | |||||||||||||||| | ||||| || ||||| ||||||||||| |||||||||| |||||||    
7446292 tgtaactttgttttgcctctttatgcactccttgtgctacgaagcaagac-ttttgattgttaatatatatctcattttggcttgtt 7446207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 285
Target Start/End: Original strand, 31110831 - 31110908
Alignment:
208 tgtaattttgttttacttctctttgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcatttt 285  Q
    ||||| |||||||| | ||| ||||||||||||||| || |||| ||||| ||||| ||||||||||| ||||||||||    
31110831 tgtaactttgttttgcctctatttgcactccttgtgttagggagaaaaac-ttttggttgttaatatatatctcatttt 31110908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 144
Target Start/End: Original strand, 38948353 - 38948414
Alignment:
85 gttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttg 144  Q
    ||||||||||||||||||||  ||||| |||||| || || ||||||||||| |||||||||    
38948353 gttgaaagcaaaaaatgtgtgctttccttttggttatcatttgtggtggcagcatccccttg 38948414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 94 - 175
Target Start/End: Original strand, 8933217 - 8933298
Alignment:
94 aaaaaatgtgttttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatgattattttt 175  Q
    |||| ||||| ||||| |||||| || |||||||||||||| ||||||||   ||||||||||| || ||||| || |||||    
8933217 aaaatatgtgctttccttttggttatcatatgtggtggcagcatccccttatttgtttggggattggttgatgttttttttt 8933298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 293
Target Start/End: Original strand, 26017828 - 26017889
Alignment:
232 gcactccttgtgctatggagcaaaactttttgtttgttaatataatctcattttagcttgtt 293  Q
    ||||||||||||||| ||||||| ||| |||  | |||||||| |||||||||| |||||||    
26017828 gcactccttgtgctagggagcaagactattttgtcgttaatattatctcattttggcttgtt 26017889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0394 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0394
Description:

Target: scaffold0394; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 166
Target Start/End: Original strand, 5204 - 5346
Alignment:
26 aacaaagccaatacgacggtgcagttagtggagaaggtgaagatgttctcacttcggtggttgaaagcaaaaaatg--tgttttccctttggtcattata 123  Q
    ||||||| ||||||||||||||||||| | || || || |||||||  || ||||| ||||||||||| |||||||  |||||||| |||||| || ||     
5204 aacaaagacaatacgacggtgcagttattcgaaaaagttaagatgtgttctcttcgttggttgaaagctaaaaatgtatgttttccttttggttatcatt 5303  T
124 tgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    | ||||  ||| ||||| |||  ||||||||||| | ||||||    
5304 tatggtaacagcatccctttgtttgtttggggattgactgatg 5346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 83 - 166
Target Start/End: Original strand, 39295847 - 39295932
Alignment:
83 tggttgaaagcaaaaaatgtgt--tttccctttggtcattatatgtggtggcagaatccccttgaatgtttggggataggctgatg 166  Q
    ||||||||| ||||||||||||  ||| | |||||| ||||||||||||||||| ||||||||   ||||||||||| | ||||||    
39295847 tggttgaaaacaaaaaatgtgtgcttttcatttggttattatatgtggtggcagcatccccttatttgtttggggattgactgatg 39295932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 293
Target Start/End: Original strand, 21431558 - 21431620
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    |||||||||||||||| ||| ||| |||||||| ||||||||||| |||||||||| |||||||    
21431558 tgcactccttgtgctagggaccaagactttttg-ttgttaatatatatctcattttggcttgtt 21431620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 293
Target Start/End: Original strand, 44593933 - 44593995
Alignment:
231 tgcactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    |||||||||||||||| ||||||| |||||| | ||||||||||| |||||||||| |||||||    
44593933 tgcactccttgtgctagggagcaagacttttag-ttgttaatatatatctcattttggcttgtt 44593995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 293
Target Start/End: Original strand, 25754823 - 25754884
Alignment:
233 cactccttgtgctatggagcaaaactttttgtttgttaatata-atctcattttagcttgtt 293  Q
    |||||| |||||||  |||||| |||||||| ||||||||||| |||||||||| |||||||    
25754823 cactccatgtgctagagagcaagactttttggttgttaatatatatctcattttggcttgtt 25754884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University