View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11739_low_21 (Length: 231)
Name: NF11739_low_21
Description: NF11739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11739_low_21 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 21073 - 20862
Alignment:
| Q |
1 |
gtgttaatttattgtgtttctcttgttttgtttaaaccagatgtataggagtatgagaggtgactcatgcaaacaaggtacaaaacaatgtctctcacct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21073 |
gtgttaatttattgggtttctcttgttttgtttaaaccagatgtataggagtatgagaggtgactcatgcaaacaaggtacaaaacaatgtctctcacct |
20974 |
T |
|
| Q |
101 |
tccttagtataaagctttaatatttattattgtttactagagtattttcagatcattgttcttttgtttaaaattttattcattagaatgtcatgataca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20973 |
tccttagtataaagctttaatatttattattctttattagagtgttttcagatcattg---ttttgtttaaaattttattcattagaatgtcatgataca |
20877 |
T |
|
| Q |
201 |
-ttgatgcatgatgc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20876 |
tttgatgcatgatgc |
20862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University