View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1173_low_12 (Length: 276)
Name: NF1173_low_12
Description: NF1173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1173_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 37 - 238
Target Start/End: Complemental strand, 49512191 - 49511997
Alignment:
| Q |
37 |
catagggataacgacagtatcatcatcaaaattttccctccttaacctccatctccatgtaagtactcttactttacttattacgtgtctacatgaaaat |
136 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49512191 |
cataaggataacgacaatatcatcatcaaaattttccctccttaacctccatctccatgtaagtactcttactt-----attacgt--ctacatgaaaat |
49512099 |
T |
 |
| Q |
137 |
ttcacttttgcattatttcatatatgtatgacacttgttttgattgcacaaagcaaggggaaaagaaacataaactatatataacgtcatgttgcactta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49512098 |
ttcacttttgcattatttcatatatgtatgacacttgttttgattgcacaaagcaagggtaaaagaaacataaactatatataacgtcatgttgcactta |
49511999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University