View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1173_low_19 (Length: 251)
Name: NF1173_low_19
Description: NF1173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1173_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 9079898 - 9079664
Alignment:
| Q |
1 |
cctttctcacaactaccgtatacacaatcatatcatatcatatcaaaataaattttgggccaactagtttctgaaaactcacgaatatttgctatcatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9079898 |
cctttctcacaactaccgtatacacaatcatatcatatcatatcaaaataaattttgggccaactagtttctgaaaactcacgaatattcgctatcatat |
9079799 |
T |
 |
| Q |
101 |
atgataccctatctaattctattgccttaggttttaaatttttagataagctaaacaaatttattgaaacatttaaagaacatgtaaacttagggatgaa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9079798 |
atgataccctatctaaatctattgccttaggttttaaatttttagataagctaaacaaatttattgaaacatttaaagaacatgt-aacttagggatgaa |
9079700 |
T |
 |
| Q |
201 |
tccaattataaaagttgagtttaccctaactctatt |
236 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9079699 |
tcaaattataaaagttgagtttaccctaactctatt |
9079664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University