View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1173_low_21 (Length: 245)
Name: NF1173_low_21
Description: NF1173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1173_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 8918444 - 8918636
Alignment:
| Q |
1 |
tttcaacacttgataaaactttggaagatacccacatagtgaaagaaaaattcttacacatatgtcagatcgaccatgaatatttgttggtggataatga |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8918444 |
tttcaacacttgataagactttggaagatacccacattgtgaaagaaaaattcttacacatatgtcagatcgaccatgaatatttgttggtggataatga |
8918543 |
T |
|
| Q |
101 |
tatgcctggttgtcatcgttgttcatgataacggcactataaattaattgatcattggaggatcaagtattcatagaattctgaataagaaac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8918544 |
tatgcctggttgtcatcgttgttcatgataacggcactataaattaattgatcattggaggatcaagtattcatagaattctgaataagaaac |
8918636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University