View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_high_22 (Length: 326)
Name: NF11740_high_22
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 1286378 - 1286566
Alignment:
| Q |
16 |
aaatacttacagagctatttctaggtaccatgaccataccagagagtgcctcggctgccactgttggctttcacgaagtctggatctagtgaggcttttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1286378 |
aaatacttacagagctatttctaggtaccatgaccataccagagagtgcctcggctgccactgttggctttcacgaagtctggatctggtgaggcttttg |
1286477 |
T |
 |
| Q |
116 |
cacgattgactgcggtttcaaaagtgataggcttttgcacgattgcacgaaaaagtgatatgtatggtgaagaatcaggaggatgaaga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1286478 |
cacgattgactgcggtttcaaaagtgataggcttttgcacgattgcacgaaaaagtgataggtatggtgaagaatcaggaggatgaaga |
1286566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University