View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11740_high_22 (Length: 326)

Name: NF11740_high_22
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11740_high_22
NF11740_high_22
[»] chr4 (1 HSPs)
chr4 (16-204)||(1286378-1286566)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 1286378 - 1286566
Alignment:
16 aaatacttacagagctatttctaggtaccatgaccataccagagagtgcctcggctgccactgttggctttcacgaagtctggatctagtgaggcttttg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
1286378 aaatacttacagagctatttctaggtaccatgaccataccagagagtgcctcggctgccactgttggctttcacgaagtctggatctggtgaggcttttg 1286477  T
116 cacgattgactgcggtttcaaaagtgataggcttttgcacgattgcacgaaaaagtgatatgtatggtgaagaatcaggaggatgaaga 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
1286478 cacgattgactgcggtttcaaaagtgataggcttttgcacgattgcacgaaaaagtgataggtatggtgaagaatcaggaggatgaaga 1286566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University