View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_high_34 (Length: 252)
Name: NF11740_high_34
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 27262452 - 27262672
Alignment:
| Q |
18 |
gtgccaaggtctagacggtcttgcctctcgttcagctgcatactaccagcaaggtgctcatttcgccaaatggttagtgtctacttgaccccctttggaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27262452 |
gtgccaaggtctagacggtcttgcctctcgttcagctgcatactaccagcaagatgctcatttcgccaaatggttagtgtctacttgaccccctttggaa |
27262551 |
T |
 |
| Q |
118 |
gcaaaatcaaaatttcatgcacttatttgtcnnnnnnnactgtcagtatttcttgtcatgctcannnnnnnaactattcaaatttcaatcacatattagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27262552 |
gcaaaatcaaaatttcatgcacttatttgtctttttttactgtcagtatttcttgtcatgctcatttttttaactattcaaatttcaatcacatattagg |
27262651 |
T |
 |
| Q |
218 |
cgtactgttgtgagcatcccc |
238 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
27262652 |
cgtactgttttgagcatcccc |
27262672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 21194965 - 21195044
Alignment:
| Q |
18 |
gtgccaaggtctagacggtcttgcctctcgttcagctgcatactaccagcaaggtgctcatttcgccaaatggttagtgt |
97 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
21194965 |
gtgccaaggtctggacggtcttgcctctcgttcagctgcatactaccaacaaggtgctcgtttcgccaaatggtgagtgt |
21195044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 27250738 - 27250817
Alignment:
| Q |
18 |
gtgccaaggtctagacggtcttgcctctcgttcagctgcatactaccagcaaggtgctcatttcgccaaatggttagtgt |
97 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||| ||||| |
|
|
| T |
27250738 |
gtgccaaggtctggacggtcttgcctctcgttcagctgcatactaccaacaaggtgctcgttttgccaaatggtgagtgt |
27250817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 21195125 - 21195166
Alignment:
| Q |
196 |
caaatttcaatcacatattaggcgtactgttgtgagcatccc |
237 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21195125 |
caaatttcaattgcatattaggcgtactgttgtgagcatccc |
21195166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 27250876 - 27250917
Alignment:
| Q |
196 |
caaatttcaatcacatattaggcgtactgttgtgagcatccc |
237 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27250876 |
caaatttcaattgcatattaggcgtactgttgtgagcatccc |
27250917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University